Stably Silencing of CD81 Expression by Small Interfering RNAs Targeting 3’-NTR Inhibits HCV Infection
Authors:
Ding H
Department of Microbiology, Shanghai Key Laboratory of Medical Biodefense, Second Military Medical University, Shanghai 200433, China
Liu Y
Department of Microbiology, Shanghai Key Laboratory of Medical Biodefense, Second Military Medical University, Shanghai 200433, China
Bian Z
Center for Infectious Diseases, Kunming General Hospital of People's Liberation Army, Kunming 650032, China
Wu W
Department of Microbiology, Shanghai Key Laboratory of Medical Biodefense, Second Military Medical University, Shanghai 200433, China
Zhao P
Department of Microbiology, Shanghai Key Laboratory of Medical Biodefense, Second Military Medical University, Shanghai 200433, China
Qin Z
Department of Microbiology, Shanghai Key Laboratory of Medical Biodefense, Second Military Medical University, Shanghai 200433, China
Feitelson MA
Department of Biology, College of Science and Technology, Temple University, Philadelphia, PA 19122, USA
Qi Z
Department of Microbiology, Second Military Medical University, Shanghai 200433, China
Correspondence:
Zhong-Tian Qi, Ph.D.
Department: Department of Microbiology, Second Military Medical University
Address: 800 Xiang-yin Road
City: Shanghai 200433
Country: China
E-mail: qizt@smmu.edu.cn
Tel: +86 21 25070312
Fax: +86 21 25070312
Abstract:
Background and Aims: Hepatitis C virus (HCV) entry, as the first key step during virus infection, includes cell attachment, interactions of virus envelope proteins with receptors or co-receptors on cell surface, membrane fusion and so on. Human CD81 is identified as an important receptor for HCV, which is known to interact with HCV E2 protein. The objectives of this study were to further determine the association between CD81 and HCV cell entry and provide information for the exploring of new anti-HCV agents.
Methods: In this study, the recombinant plasmid pEGFP-CD81 was firstly constructed using green fluorescence protein (GFP) as reporter gene. Six small interfering RNAs (siRNA) targeting the open reading frame (ORF) or 3'-nontranslated region (3'-NTR) of CD81 genome were transcribed in vitro and transfected into pEGFP-CD81 expressing cells for the screening of silence effect. The most effective siRNA was selected to construct the short hairpin RNA (shRNA) - expressing plasmid pGCsi-CD81, which was stably transfected into Huh7.5 cells. After screening by G418, two cell clones with the CD81 expression levels mostly reduced were infected with HCV pseudoparticles (HCVpp) or cell culture derived infectious HCV (HCVcc), while the cells stably transfected with an irrelevant siRNA were used as negative control.
Results: Our results showed that the Huh7.5 cells where CD81 was silenced were completely resistant to infection by HCVpp or HCVcc, while those cells stably transfected with an irrelevant siRNA were sensitive to HCV infection.
Conclusions: These data underscore the importance of CD81 as a receptor for HCV, and provide an approach for investigating the association between CD81 and HCV cell entry, which may be of potential value in the development of novel prophylactic or therapeutic agents for HCV infection.
Keywords: Hepatitis C Virus, CD81, Small Interfering RNAs
Introduction:
Hepatitis C virus (HCV) is an enveloped RNA virus belonging to the Flaviviridae family. HCV genome is a positive-stranded 9.6 kb RNA molecule consisting of a single ORF, which is flanked by 5'and 3'-NTR. The HCV ORF encodes a single large precursor polyprotein that is about 3000 amino acids in length which is cleaved by both cellular and viral proteases into at least ten different proteins: structural protein core, envelope proteins E1 and E2, p7, and nonstructural proteins NS2, NS3, NS4A, NS4B, NS5A and NS5B (1). The prevalence of HCV infection is about 3% worldwide (2). Most individuals acutely infected with HCV fail to clear the virus and develop chronic infections. Moreover, a large proportion of individuals progress to liver cirrhosis and hepatocellular carcinoma (3, 4). Therefore, it is urgent to develop more effective antiviral drugs other than interferon (IFN) combinate with ribavirin.
RNA interference (RNAi) is a phenomenon in which small double-stranded RNA molecules induce sequence-specific degradation of homologous mRNA (5). After being introduced into cells, the siRNAs are subsequently incorporated into a multiprotein complex which is known as the RNA-induced silencing complex (RISC). This activated RISC complex uses a single stranded siRNA to aid in identification of RNAs that are complementary to this single stranded siRNA. An endoribonuclease then cleaves this RNA, which is then thought to be degraded by exoribonucleases. In doing so, RNAi is becoming a powerful tool to investigate gene function and has been employed in therapeutic studies of human diseases, including cancer, neurogenerative diseases, and viral infectious diseases (6).
Cell attachment, the first step of viral life cycle, is mediated by binding of virion envelope proteins to receptors at the target cell surface. Several cellular molecules have been identified as receptors or co-receptors for HCV. These molecules include CD81, scavenger receptor class B type I, integrin, low-density lipoprotein receptor, heparan sulphate proteoglycans, the asialoglycoprotein receptor (7), and claudin-1 (8). CD81 is a member of the tetraspanin family, containing four transmembrane domains, short intracellular domains and two extracellular loops called the small extracellular loop (SEL) and the large extracellular loop (LEL). It is believed that the interaction of HCV E2 glycoprotein and the LEL of CD81 plays an important role in HCV cell entry (9, 10), and, accordingly, CD81 was selected as the RNA interference target in our studies on inhibition of HCV infection. .
In the present study, six candidate small interfering RNA (siRNAs) targeting CD81 were designed and tested for their abilities to silence the expression of the CD81 gene. Then the most effective siRNA was cloned into the expression plasmid pGCsi-U6/Neo/RFP (red fluorescence protein) to obtain the shRNA expressing plasmid pGCsi-CD81, which was stably transfected into Huh7.5 cells. The resulted cells were infected with HCV pseudoparticles (HCVpp) or HCV grown in cell culture (HCVcc). Our data showed that suppression of CD81 gene in the target cells effectively inhibited HCV cell entry, which provide us a platform for further study of the functions of other molecules associated with this process as well as the precise mechanism of HCV cell entry.
Materials And Methods:
Preparation of CD81 specific siRNAs
Four siRNAs corresponding to the CD81 open reading frame (ORF): nt 206-226, 482-502, 554-574, 641-661, and two additional siRNAs corresponding to the 3'-nontranslated region (NTR) of CD81: nt 840-860 and 1209-1229 (Fig.1), were designed according to manufacturer's recommendations (Ambion). siRNA with a scrambled sequence (11) and an Enhanced Green Fluorescence Protein (EGFP) specific siRNA (12), were used as negative and positive controls, respectively. The template deoxynucleotides (Table 1) used for siRNA transcription were synthesized from Invitrogen (Shanghai, China). They were composed of an 8-nucleotide leader sequence at the 5'-end of each oligonucleotide complementary to a region of the T7 RNA polymerase promoter, followed by an adenine dinucleotide and another 19 bases complementary to CD81. A final concentration of 0.3 nM of each oligonucleotide template and T7 primer were mixed and denatured by heating at 95°C for 2 min. 10×Klenow reaction buffer, dNTPs, and Exo-Klenow polymerase (TaKaRa, Dalian, China) were then added, and the mixture were incubated at 37°C for 30 min to allow for annealing and extension. The generated dsDNA templates were used for in vitro transcription, which was carried out for 2 h at 37°C using the T7 RiboMax Express RNAi System (Promega, Madison, WI). The transcription reactions for each sense and antisense siRNA were mixed and incubated at 37°C overnight. S1 nuclease and RNase-free DNase I were added for digestion of single-stranded RNA and double stranded DNA respectively. The double stranded siRNA was extracted with phenol: chloroform: isoamyl alcohol (25:24:1) and precipitated with ethanol. RNA pellets were washed with 70% ethanol and resuspended in nuclease-free water.
Table 1. Sequences of template deoxynucleotides for siRNAs.
Target genes |
| Sequences |
T7 promoter |
| 5'-TAATACGACTCACTATAGGAGACAGG-3' |
EGFP-siRNA | antisense | 5'-AAGCTGACCCTGAAGTTCATCCCTGTCTC-3' |
| sense | 5'-AAGATGAACTTCAGGGTCAGCCCTGTCTC-3' |
Scramble siRNA | antisense | 5'-AACAAGTCTCGTATGTAGTGGCCTGTCTC-3' |
| sense | 5'-AACCACTACATACGAGACTTGCCTGTCTC-3' |
CD81-siRNA1 | antisense | 5'-AACACCTTCTATGTAGGCATCCCTGTCTC-3' |
| sense | 5'- AAGATGCCTACATAGAAGGTGCCTGTCTC-3' |
CD81-siRNA2 | antisense | 5'-AAGACCTTCCACGAGACGCTTCCTGTCTC-3' |
| sense | 5'- AAAAGCGTCTCGTGGAAGGTCCCTGTCTC-3' |
CD81-siRNA3 | antisense | 5'- AACAATTTGTGTCCCTCGGGCCCTGTCTC-3' |
| sense | 5'- AAGCCCGAGGGACACAAATTGCCTGTCTC-3' |
CD81-siRNA4 | antisense | 5'- AAGCTGTACCTCATCGGCATTCCTGTCTC-3' |
| sense | 5'- AAAATGCCGATGAGGTACAGCCCTGTCTC-3 |
CD81-siRNA5 | antisense | 5'- AACGTTTCCGGTATTACTCTGCCTGTCTC-3 |
| sense | 5'- AACAGAGTAATACCGGAAACGCCTGTCTC-3' |
CD81-siRNA6 | antisense | 5'- AACACGTCGCCTTCAACTGTACCTGTCTC-3' |
| sense | 5'- AATACAGTTGAAGGCGACGTGCCTGTCTC -3' |
Note. The eight nucleotide (nt) underlined sequences of template deoxynucleotides for synthesis of siRNA are complemented with those of T7 promoter primer. CD81-siRNA 1, 2, 3 and 4 target the ORF of CD81 gene, while CD81-siRNA 5 and 6 target 3' NTR of CD81 gene.
Selection of effective CD81 specific siRNAs
Construction of plasmids: Total RNA was extracted from Huh7 cells using RNArose reagent (Watson, Shanghai, China) and reverse transcribed into cDNA using oligodT (18T) as primer. The generated cDNA was used as template to amplify the full-length CD81 gene including the ORF and 3'-NTR using oligonucleotide primers. Sense and antisense primers were 5'-GAATTCATGGGAGTGGAGGGCTGCAC-3' and 5'-GGATCCAGCATGCCTGATGTTCCTTC-3'. The resulted DNA fragments were inserted into the EcoRI and BamHI restriction sites of the pEGFP-C2 vector (Clontech, Mountain View, CA) containing green fluorescent protein (GFP) reporter gene to obtain the plasmid pEGFP-CD81 (Fig.1). Identity of CD81 gene to the published sequence (GenBank accession no. NM_004356) was confirmed by sequencing.
Cell culture and transfection: HEK 293T cells were grown in Dulbecco's modified Eagle's medium (DMEM; Sigma, St. Louis, MO) containing 10% fetal bovine serum (Gibco-BRL, Gaithersburg, MD), 1 mM L-glutamine, 100 |m|g/ml streptomycin and 100 U/ml penicillin. Cells seeded in 24-well plates (1×105 cells/well) were cultured for 24 h, and then transfected with either 0.8 |m|g pEGFP-CD81 or a combination of pEGFP-CD81 and 2 mg specific or control CD81 siRNAs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's instructions.
Flow cytometric analysis: HEK 293T cells were harvested at 48 h post-transfection, washed with phosphate-buffered saline for twice, then the GFP fluorescence was measured using a Becton-Dickinson FACScan flow cytometer and analyzed with CellQuest software.
Real-time quantitative PCR: At 48 h post-transfection, total cellular RNA was extracted and transcribed into cDNA as described above. RNA level of CD81 was quantified by real-time PCR in a Rotor-Gene 3000 Real-time Thermal Cycler (Corbett, Sydney, Australia) using SYBR Premix Ex Taq (TaKaRa, Dalian, China). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primers for GAPDH were 5'-TGGGCTACACTGAGCACCAG-3' and 5'-AAGTGGTCGTTGAGGGCAAT-3' (13). Primers for CD81 were 5'-GGCATCTGGGGCTTTGTCAAC-3' and 5'-GAGCCACAGCAGTCAAGCGT C-3'.
Western blotting: At 48 h post-transfection, HEK 293T cells were harvested and lysed. Equal amount of protein was separated on SDS polyacrylamide gel and transferred onto nitrocellulose membrane. Blots were probed with CD81 or GAPDH (Kangcheng, China) specific monoclonal antibodies. Signal was developed with alkaline phosphatase-conjugated secondary antibody and nitro blue tetrazolium plus 5-bromo-4-chloro-3-indolyl-phosphate substrates.
Figure 1. Schematic representation of the plasmid pEGFP-CD81 and the position of CD81 specific siRNAs.
Construction of Huh7.5 cells stably expressing CD81 specific siRNA
shRNA annealing and plasmid construction: The most effective siRNA (CD81-siRNA5) was selected. Based on its sequence, a CD81 shRNA expression plasmid was constructed. The sense oligomer of CD81 shRNA was synthesized as 64 nt single-stranded DNA oligomers composed of the CD81-siRNA5 forward and reverse sequences containing 9-bp loop structures with 3' BamHI and 5' HindIII self-inactivating overhangs and a terminator sequence. Its sequence was 5'-GATCC GCGTTTCCGGTATTACTCTG TTCAAGAGA CAGAGTAATACCGGAAACG TTTTTTGGAA AA-3' (Sequence in bold: BamHI or HindIII self-inactivating overhangs; Sequence underlined: loop; Sequence in Italic: terminator) and the sequence of antisense oligomer was 5'-AGCTT TTCCAAAAAA CGTTTCCGGTATTACTCTG TCTCTTGAA CAGAGTAATACCGGAAACG CG-3' which was complemented to the sense oligomer. The negative control plasmid, pGCsi-scramble, containing a scrambled siRNA sequence, was also constructed. The sequence of the sense oligomer was: 5'- GATCC GCAAGTCTCGTATGTAGTGG TTCAAGAGA CCACTACATACGAGACTTG TTTTTTGGAA AA -3' and the sequence of antisense oligomer was: 5' -AGCTT TTCCAAAAAA CAAGTCTCGTATGTAGTGG TCTCTTGAA CCACTACATACGAGACTTG CG-3'. These two single-stranded DNA oligomers were proposed to construct the CD81 or scrambled shRNA double stranded DNA template and subcloned into the expression plasmid pGCsi-U6/Neo/RFP to obtain pGCsi-CD81 or pGCsi-scramble. Sense and antisense oligomers at 20 |m|M were incubated in annealing buffer for 2 min at 95°C, then temperatures were lowered at the rate of 1°C/90 sec increments to a final temperature of 25°C, and dropped to 4°C at maximum ramp rates. Annealed shRNA oligomers were inserted into BamHI and HindIII digested pGCsi-U6/neo/RFP. Appropriate shRNA cloning was confirmed by sequencing.
Transfection and screening: Five micrograms of plasmid pGCsi-CD81 or pGCsi-scramble (negative control) was electroporated into 5×106 Huh7.5 cells (3 pulses of 820V for 0.1ms with 1s intervals on a Bio-Rad electroporator). After incubation at room temperature for 10 min, cells were cultured in complete DMEM medium for 48 h and then changed with medium containing 300 µg/ml of G418 for the isolation of shRNA expressing cell clones. The isolated cell clones were expanded in complete medium containing G418. Huh7.5 cells transfected with pGCsi-scramble were served as a negative control. Cell surface expression of CD81 in the cell clones was analyzed by flow cytometry on a Becton-Dickinson FACScan flow cytometer. In Brief, the cell clones were harvested and incubated with CD81 monoclonal antibody (1:100 dilution, Ancell, MN) for 1 h, washed with phosphate-buffered saline, followed by incubation with FITC-conjugated anti-mouse immunoglobulin G (1:100 dilution, Vector Labs) for 30 min. Cells were washed and GFP fluorescence was then analyzed with CellQuest software.
HCVpp production and infection
HEK 293T cells in 24-well plates (1×105 cells/well) were cultured for 24 h and then transfected with pcDNA3-HCV-E1/E2, pCMV-gag-pol, or pCMV-GFP using Lipofectamine 2000 following the manufacturer's instructions. At 24 h post-transfection, supernatant containing HCVpp was collected.
For HCVpp infection assays, Huh7.5, Huh7.5-scramble, and Huh7.5 cells expressing CD81 shRNA were seeded in 12-well plates (5×104 cells/well) one day before. Five microliters of supernatant containing HCVpp was added to each well. After 16 h infection, cells were changed with a fresh complete medium, incubated for another 52 h, and analyzed by flow cytometry.
HCVcc production and infection
HCVcc was produced by transfection of FL-J6/JFH1 into Huh7.5 cells using Lipofectamine 2000. On day 14, supernatant containing viral particles was collected.
One day before, Huh7.5, Huh7.5-scramble, and Huh7.5 cells expressing CD81 siRNA were seeded in 24-well plates (5×104 cells/well) or 96-well plates (1×104 cells/well) for HCVcc infection. Infectious supernatant was added to 24-well plates (50 |m|l/well) or 96-well plates (10 ml/well). After infection for 10 h, cells were incubated in a fresh medium. At 72 h post-inoculation, total RNA was extracted from cells in 24-well plates, and HCV positive strand was quantified by real-time PCR using the primers RC21: 5'-CTCCCGGGCACTCGCAAGC-3', and RC1: 5'-GTCTAGCCATGGCGTTAGTA-3' (14). Cells in 96-well plates were fixed with methanol and stained with serum from HCV infected patients (1:100 dilution) and FITC-conjugated anti-human immunoglobulin G (1:100 dilution, Vector Labs). Positive cells were counted under a fluorescence microscope.
Results:
Screening for effective CD81 siRNAs
To determine whether siRNAs could effectively inhibit CD81 expression, the transfected HEK 293T cells were examined by fluorescence microscopy at 48 h post-transfection. As shown in figure 2.A, the percentage of GFP positive HEK 293T cells co-transfected with pEGFP-CD81 with or without scrambled siRNA was similar. However, the GFP signal was much lower in cells co-transfected with CD81 specific siRNA. The percentage of positive cells transfected with siRNA 1 or siRNA 3 was similar to that of cells transfected with pEGFP-CD81 alone. The latter were much higher than the GFP signals observed in cells co-transfected with siRNA 2, siRNA 4, siRNA 5 or siRNA 6. These observations were confirmed by Western blotting, which showed that the levels of EGFP-CD81 fusion protein in cells co-transfected with CD81-siRNAs 2, 4, 5 or 6 were much lower compared to those in negative controls using scrambled siRNA. In contrast, the levels of EGFP-CD81 fusion protein expressed in cells transfected with siRNA 1 or siRNA 3 were similar to those in the negative control. In this experiment, the signals in all lanes were normalized to those of GAPDH, which was used as a loading control (Fig. 2.B). Flow cytometry further strengthened these observations by showing that the co-transfection of scrambled siRNA and pEGFP-CD81 induced no obvious changes in EGFP-CD81 expression, whereas the mean fluorescence intensity (MFI) of siRNAs 2, 4, 5 or 6 was reduced about 10.1-fold. MFI of CD81-siRNA 1 or siRNA 3 transfected cells was similar to that of negative control, indicating little inhibition of CD81 expression. Specifically, the MFI of CD81-siRNAs 2, 4, 5 or 6 transfected cells was 5.9-, 4.3-, 6.1- and 7.9-fold lower, respectively, than the scrambled siRNA control (Fig. 2.C). In addition, real-time PCR showed that, at 48 h post-transfection, in comparison with negative controls, CD81 gene transcription levels in cells transfected with the EGFP-siRNA, CD81-siRNAs 2, 4, 5 or 6 were decreased to 95.5%, 86.5%, 81.1%, 87.3% or 91.2%, respectively, while decreases of only 17% and 30% were observed in cells transfected with CD81-siRNA 1 or 3 (Fig. 2.D).
Figure 2. Effects of the siRNAs on EGFP-CD81 expression in transfected HEK 293T cells. The transfected plasmids are: lane 1, pEGFP-CD81; lane 2, pEGFP-CD81 and scramble siRNA; lane 3, pEGFP-CD81 and EGFP-siRNA; lane 4, pEGFP-CD81 and CD81-siRNA1; lane 5, pEGFP-CD81 and CD81-siRNA2; lane 6, pEGFP-CD81 and CD81-siRNA3; 7, pEGFP-CD81 and CD81-siRNA4; 8, pEGFP-CD81 and CD81-siRNA5; 9, pEGFP-CD81 and CD81-siRNA6. (A). Upper panels represent the cell fluorescence images recorded at 48 h post transfection. Bottom panels represent the light microscopic view of cells in the same field. (B). Effect of siRNAs on CD81-EGFP expression in HEK 293T cells. Western blotting was performed on equal amounts of proteins harvested from mock or siRNA co-transfected HEK 293T cells at 48 h post-transfection. GAPDH was used as a loading control. (C). Effects of CD81 specific siRNA on CD81-EGFP expression in HEK 293T cells by flow cytometry. (D). Effects of siRNA on CD81 mRNA levels as detected by real-time PCR. This assay shows the percentage of CD81 mRNA in siRNAs-transfected HEK 293T cells over those in pEGFP-CD81 transfected cells following normalizing with GAPDH mRNA. Data represent means ± SD of 3 independent experiments.
Stable suppression CD81 in Huh7.5 cells
The CD81-siRNA 5 expression plasmid, pGCsi-CD81, was constructed and electroporated into Huh7.5 cells. The cells were cultured in a medium containing G418 and about 50 cell clones were obtained 3 weeks later. Among these clones, 11 cell clones (A1, A4, A5, A6, A8, A9, A10, C1, E3, E8, and E11) were selected and levels of CD81 expression were analyzed by flow cytometry. The results showed that the levels of CD81 expression were depressed to variable extents in different clones. Figure 3 shows that the levels of CD81 expression in clones A4, E3 and E8 were inhibited to 40~50%, while in clone C1, CD81 expression was 92% inhibited.
Figure 3. Detection of the CD81 cell surface expression levels of 11 cell clones by flow cytometry. The MFI were calculated and the MFI of the Huh-scramble was set as 100%. Data represent means ± SD of 3 independent experiments.
Infection of Huh7.5 cells with HCVpp or HCVcc
The cell clones C1 and A5, in which CD81 expression was strongly inhibited, were selected to test for infection by HCVpp or HCVcc. Naive Huh7.5 and Huh7.5 stably transfected with scrambled siRNA were used as negative controls. Their levels of fluorescence were similar. Flow cytometry with other clones showed a 90% decrease in fluorescence signal in clone C1 and a 82% decrease in clone A5 (Fig. 4.A). In the HCVcc infection assay, indirect immunofluorescence was applied to evaluate influence of CD81 inhibition on HCV cell entry. As shown in figure 4.B, infectivity in clones C1 or A5 was 98.4% and 87% less than that of Huh7.5 transfected with scrambled siRNA. Reverse transcription real-time quantitative PCR analysis further showed that HCV RNA levels in C1 and A5 clones were only 2.5% and 26.7%, respectively, of the levels observed in Huh7.5 transfected with scrambled siRNA (Fig. 4.C).
Figure 4. Effect of CD81 suppression on HCV infection. (A). FACS analysis on 4 d after HCVpp infection. (B). The positive cell number of 10 random fields after HCVcc infection for 72 h by indirect immunofluorescence. (C). The relative ratio of HCV RNA levels after HCVcc infection for 72 h by real-time quantitative PCR. Data represent means ± SD of 3 independent experiments.
Discussion:
In this study, simple reporter gene assays (15) were used to evaluate the abilities of different siRNA to suppress CD81 expression with the goal of critically assessing the role of CD81 in HCV infection. An important aspect of determining the efficacy of the CD81 siRNAs depended upon the production of native CD81 template mRNA. Considering the long 3'-NTR of CD81 gene may participate in the secondary structure of CD81 mRNA, both the ORF and 3'-NTR of CD81 were thus included in the plasmid pEGFP-CD81, yielding an mRNA template that was likely to display correct conformation. Our results showed that the CD81 siRNAs 2, 4, 5, and 6 reduced the CD81 expression, while the CD81 siRNAs 1 and 3 had no apparent silencing effects. The most effective siRNAs were the CD81 siRNAs 5 and 6, which both targeted the 3'-NTR of CD81.
Previous works showed that the effective CD81 specific siRNAs all targeted the ORF of CD81 gene (10, 16-18). In contrast, our results showed that two siRNAs targeting the 3'-NTR reduced CD81 expression level to 8% of controls, suggesting that the 3'-NTR should also be considered when selecting targets for silencing eukaryotic genes.
Current therapy for HCV infection is mainly the combination use of interferon and ribavirin, but only about half of the treated patients obtain a sustained antiviral response. Hence, the development of new therapies for HCV infection is urgent. Inhibitory properties of siRNAs on several components of HCV life cycle have provided a new approach for antiviral therapy (19, 20). However, interference of viral replication may result in the appearance of virus mutants resistant to the siRNA (21). During the virus life cycle, the cell-virion binding is determinant of the entry process (22). Target cells encode molecules that act as membrane receptors for virus penetration, and cellular transcription factors that promote viral replication. Targeting these cellular genes may be another strategy for inhibiting virus infections. For example, it has been shown that the siRNAs targeted to the HIV-1 CD4 receptor (23) or CCR5 co-receptor (24), could suppress HIV-1 entry and replication. Since CD81 is an HCV receptor, siRNAs for CD81 should demonstrate significant antiviral effects without the appearance of resistance, which might be useful in the prevention of HCV reinfection. Previous studies showed that the transient suppression of CD81 in Huh7.5 cells by CD81 specific siRNAs reduced CD81 cell surface expression and HCVpp infection (10). Our results demonstrated that long term suppression of CD81 also efficiently inhibited the infection of HCVpp and HCVcc. These data suggest that CD81 plays an important role in HCV cell entry and that the CD81 specific siRNAs could shed further light on diverse strategies to interfere with HCV infection.
CD81 is involved in for HCV cell entry, but its exact role is still not well understood. Co-expression of CD81 and scavenger receptor class B type I on non-hepatic cell lines does not facilitate HCVpp entry (25). This suggests that additional molecules are still needed for HCV entry. The creation of CD81 silenced cell lines that are resistant to HCV infection will be useful for further dissecting the role of CD81 as well as other molecules involved in HCV entry. As CD81 is reported to affect adhesion, morphology, activation, proliferation, and differentiation of B, T and other cells, whether its down regulation could induce some side effects on cells' vital movements should be further studied.
In summary, the data showed that the CD81 specific siRNAs reduced CD81 gene expression at different levels. Interestingly, two siRNAs targeted to the CD81 3'-NTR were much more effective than the others. The Huh7.5 cell lines where CD81 was stably silenced were resistant to HCV infection. These results provide a novel approach to study possible associations between CD81 expression and HCV cell entry as well as for the development of novel prophylactic or therapeutic agents for HCV infection.
Acknowledgments:
The first two authors contributed equally to this work. We are grateful to Rice C.M. (Rockefeller University, New York) and Wakita T (Department of Virology II, National Institute of Infectious Diseases, Shinjuku, Tokyo, Japan) for providing us with pFL-J6/JFH1. This work was financially supported by the Natural Science Foundation of China (No. 30771926), the Shanghai Leading Academic Discipline Project (No. B901) and the National Key Basic Research and Development Project of China (973 No. 2009CB522503).
References:
1. Farci P, Choo QL, Kuo G, et al. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome [Science 1989;244:359-362]. J Hepatol. 2002;36(5):582-5. [PubMed]
2. Shepard CW, Finelli L, Alter MJ. Global epidemiology of hepatitis C virus infection. Lancet Infect Dis. 2005;5(9):558-67. [PubMed]
3. Hoofnagle JH. Hepatitis C: the clinical spectrum of disease. Hepatology. 1997;26(3 Suppl 1):15S-20S. [PubMed]
4. Theodore D, Fried MW. Natural history and disease manifestations of hepatitis C infection. Curr Top Microbiol Immunol. 2000;242:43-54. [PunbMed]
5. Hannon GJ. RNA interference. Nature. 2002;418(6894):244-51. [PubMed]
6. Dykxhoorn DM, Novina CD, Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nat Rev Mol Cell Biol. 2003;4(6):457-67. [PubMed]
7. Cocquerel L, Voisset C, Dubuisson J. Hepatitis C virus entry: potential receptors and their biological functions. J Gen Virol. 2006;87(Pt 5):1075-84. [PubMed]
8. Evans MJ, von Hahn T, Tscherne DM, et al. Claudin-1 is a hepatitis C virus co-receptor required for a late step in entry. Nature. 2007;446(7137):801-5. [PubMed]
9. Wakita T, Pietschmann T, Kato T, et al. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med. 2005;11(7):791-6. [PubMed]
10. Zhang J, Randall G, Higginbottom A, Monk P, Rice CM, McKeating JA. CD81 is required for hepatitis C virus glycoprotein-mediated viral infection. J Virol. 2004;78(3):1448-55. [PubMed]
11. Wilson JA, Jayasena S, Khvorova A, et al. RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc Natl Acad Sci U S A. 2003;100(5):2783-8. [PubMed]
12. Cao M, Ren H, Pan X, Pan W, Qi ZT. Inhibition of EGFP expression by siRNA in EGFP-stably expressing Huh-7 cells. J Virol Methods. 2004;119(2):189-94. [PubMed]
13. Qin ZL, Zhao P, Zhang XL, et al. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells. Biochem Biophys Res Commun. 2004;324(4):1186-93. [PubMed]
14. Besnard NC, Andre PM. Automated quantitative determination of hepatitis C virus viremia by reverse transcription-PCR. J Clin Microbiol. 1994;32(8):1887-93. [PubMed]
15. Liu M, Ding H, Zhao P, et al. RNA interference effectively inhibits mRNA accumulation and protein expression of hepatitis C virus core and E2 genes in human cells. Biosci Biotechnol Biochem. 2006;70(9):2049-55. [PubMed]
16. Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ, van der Laan LJ. Simultaneous targeting of HCV replication and viral binding with a single lentiviral vector containing multiple RNA interference expression cassettes. Mol Ther. 2006;14(4):485-93. [PubMed]
17. Koutsoudakis G, Herrmann E, Kallis S, Bartenschlager R, Pietschmann T. The level of CD81 cell surface expression is a key determinant for productive entry of hepatitis C virus into host cells. J Virol. 2007;81(2):588-98. [PubMed]
18. Mazzocca A, Sciammetta SC, Carloni V, et al. Binding of hepatitis C virus envelope protein E2 to CD81 up-regulates matrix metalloproteinase-2 in human hepatic stellate cells. J Biol Chem. 2005;280(12):11329-39. [PubMed]
19. Kanda T, Steele R, Ray R, Ray RB. Small interfering RNA targeted to hepatitis C virus 5' nontranslated region exerts potent antiviral effect. J Virol. 2007;81(2):669-76. [PubMed]
20. Prabhu R, Vittal P, Yin Q, et al. Small interfering RNA effectively inhibits protein expression and negative strand RNA synthesis from a full-length hepatitis C virus clone. J Med Virol. 2005;76(4):511-9. [PubMed]
21. Konishi M, Wu CH, Kaito M, et al. siRNA-resistance in treated HCV replicon cells is correlated with the development of specific HCV mutations. J Viral Hepat. 2006;13(11):756-61. [PubMed]
22. Molina S, Castet V, Pichard-Garcia L, et al. Serum-derived hepatitis C virus infection of primary human hepatocytes is tetraspanin CD81 dependent. J Virol. 2008;82(1):569-74. [PubMed]
23. Novina CD, Murray MF, Dykxhoorn DM, et al. siRNA-directed inhibition of HIV-1 infection. Nat Med. 2002;8(7):681-6. [PubMed]
24. Qin XF, An DS, Chen IS, Baltimore D. Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci U S A. 2003;100(1):183-8. [PubMed]
25. Bartosch B, Vitelli A, Granier C, et al. Cell entry of hepatitis C virus requires a set of co-receptors that include the CD81 tetraspanin and the SR-B1 scavenger receptor. J Biol Chem. 2003;278(43):41624-30. [PubMed]
